Review





Similar Products

92
Addgene inc single guide rnas
Single Guide Rnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pm41790804-102-1-8?v=Addgene+inc
Average 92 stars, based on 1 article reviews
single guide rnas - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

92
Addgene inc rol 6 guide rna plasmid
Rol 6 Guide Rna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pmc13016990-65-35-40?v=Addgene+inc
Average 92 stars, based on 1 article reviews
rol 6 guide rna plasmid - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

94
Addgene inc guide rna
Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pmc13031808-195-1-19?v=Addgene+inc
Average 94 stars, based on 1 article reviews
guide rna - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

97
Addgene inc prime editing guide rna
Prime Editing Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pm41708889-196-1-7?v=Addgene+inc
Average 97 stars, based on 1 article reviews
prime editing guide rna - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier

91
Santa Cruz Biotechnology 164 guide rna
164 Guide Rna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/10__1158_slash_2767___9764__crc___25___0119-68-20-28?v=Santa+Cruz+Biotechnology
Average 91 stars, based on 1 article reviews
164 guide rna - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

96
Addgene inc guide rnas grnas
Guide Rnas Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pmc12808832-201-0-17?v=Addgene+inc
Average 96 stars, based on 1 article reviews
guide rnas grnas - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

96
Addgene inc guide rna plasmid
Guide Rna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/bio_rxiv__64898__2026__01__23__701189-257-3-7?v=Addgene+inc
Average 96 stars, based on 1 article reviews
guide rna plasmid - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

96
Addgene inc chimeric guide rna expression plasmid
Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk <t>RNA</t> sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized <t>RNA</t> <t>expression</t> of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.
Chimeric Guide Rna Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pmc12803845-387-29-34?v=Addgene+inc
Average 96 stars, based on 1 article reviews
chimeric guide rna expression plasmid - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

96
Addgene inc guide rnas targeting adcyap1r1
PAC1R expression and its association with survival in neuroblastoma. A Comparison of <t>ADCYAP1R1</t> mRNA expression between normal adrenal glands and neuroblastoma tissues across multiple cohorts. Datasets from normal adrenal glands (non-neuroblastoma cases) and four neuroblastoma cohorts (Delattre, Hiyama, Lastowska, and Vesteeg; Sample sizes indicated in parentheses) were obtained from the R2: Genomics Analysis and Visualization Platform ( https://r2.amc.nl ). Statistical analysis was performed using unpaired two-tailed Student’s t- test. **** P < 0.001. B Kaplan–Meier survival curves for overall survival, stratified by ADCYAP1R1 expression in three neuroblastoma datasets: Kocak ( n = 476), Cangelosi ( n = 786), and NRC ( n = 276). C Kaplan–Meier analysis of event-free survival based on ADCYAP1R1 expression from the Kocak cohort. Red and blue lines represent high and low ADCYAP1R1 expression groups, respectively. Datasets were obtained from the R2. P values were determined using one-way ANOVA with Bonferroni post hoc test. D Surface expression of PAC1R in four neuroblastoma cell lines measured by flow cytometry. Cells were stained with anti-PAC1R antibody (AMG-301, red line) or human IgG control (black line). E , F Dose-response curves for calcium mobilization ( E ) and cAMP production ( F ) in neuroblastoma cells stimulated with PACAP38. Calcium mobilization was measured using Cal-520 AM, and cAMP production was assessed using the LANCE Ultra cAMP detection kit. For curve fitting, all data were analyzed using nonlinear regression (three-parameter fit) in GraphPad Prism, without applying constraints to the minimum or maximum values. Data represent the mean ± SEM of n = 3 independent experiments
Guide Rnas Targeting Adcyap1r1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna+plasmids/pmc12892574-49-8-25?v=Addgene+inc
Average 96 stars, based on 1 article reviews
guide rnas targeting adcyap1r1 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

Image Search Results


Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

Journal: iScience

Article Title: A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion

doi: 10.1016/j.isci.2025.114443

Figure Lengend Snippet: Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

Article Snippet: For generation of fluorescently-tagged hPSC lines EGFP or tdTM was inserted into the AAVS1 locus with a targeting plasmid (Addgene; catalog no. 22212) and a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid (Addgene; catalog no. 42230), into which the Target Guide Sequence was cloned into using the oligos: Oligo 1: CACCG GGGGCCACTAGGGACAGGAT,Oligo2 : AAAC ATCCTGTCCCTAGTGGCCCC C. After puromycin selection, EGFP or tdTM-expressing clones were manually picked.

Techniques: Derivative Assay, RNA Sequencing, Standard Deviation, RNA Expression, Expressing, Flow Cytometry, Immunofluorescence, Staining, Co-Culture Assay

PAC1R expression and its association with survival in neuroblastoma. A Comparison of ADCYAP1R1 mRNA expression between normal adrenal glands and neuroblastoma tissues across multiple cohorts. Datasets from normal adrenal glands (non-neuroblastoma cases) and four neuroblastoma cohorts (Delattre, Hiyama, Lastowska, and Vesteeg; Sample sizes indicated in parentheses) were obtained from the R2: Genomics Analysis and Visualization Platform ( https://r2.amc.nl ). Statistical analysis was performed using unpaired two-tailed Student’s t- test. **** P < 0.001. B Kaplan–Meier survival curves for overall survival, stratified by ADCYAP1R1 expression in three neuroblastoma datasets: Kocak ( n = 476), Cangelosi ( n = 786), and NRC ( n = 276). C Kaplan–Meier analysis of event-free survival based on ADCYAP1R1 expression from the Kocak cohort. Red and blue lines represent high and low ADCYAP1R1 expression groups, respectively. Datasets were obtained from the R2. P values were determined using one-way ANOVA with Bonferroni post hoc test. D Surface expression of PAC1R in four neuroblastoma cell lines measured by flow cytometry. Cells were stained with anti-PAC1R antibody (AMG-301, red line) or human IgG control (black line). E , F Dose-response curves for calcium mobilization ( E ) and cAMP production ( F ) in neuroblastoma cells stimulated with PACAP38. Calcium mobilization was measured using Cal-520 AM, and cAMP production was assessed using the LANCE Ultra cAMP detection kit. For curve fitting, all data were analyzed using nonlinear regression (three-parameter fit) in GraphPad Prism, without applying constraints to the minimum or maximum values. Data represent the mean ± SEM of n = 3 independent experiments

Journal: Cell Communication and Signaling : CCS

Article Title: Activation of the pituitary adenylate cyclase-activating polypeptide type I receptor promotes neuroblastoma proliferation and migration through distinct G protein pathways

doi: 10.1186/s12964-026-02660-2

Figure Lengend Snippet: PAC1R expression and its association with survival in neuroblastoma. A Comparison of ADCYAP1R1 mRNA expression between normal adrenal glands and neuroblastoma tissues across multiple cohorts. Datasets from normal adrenal glands (non-neuroblastoma cases) and four neuroblastoma cohorts (Delattre, Hiyama, Lastowska, and Vesteeg; Sample sizes indicated in parentheses) were obtained from the R2: Genomics Analysis and Visualization Platform ( https://r2.amc.nl ). Statistical analysis was performed using unpaired two-tailed Student’s t- test. **** P < 0.001. B Kaplan–Meier survival curves for overall survival, stratified by ADCYAP1R1 expression in three neuroblastoma datasets: Kocak ( n = 476), Cangelosi ( n = 786), and NRC ( n = 276). C Kaplan–Meier analysis of event-free survival based on ADCYAP1R1 expression from the Kocak cohort. Red and blue lines represent high and low ADCYAP1R1 expression groups, respectively. Datasets were obtained from the R2. P values were determined using one-way ANOVA with Bonferroni post hoc test. D Surface expression of PAC1R in four neuroblastoma cell lines measured by flow cytometry. Cells were stained with anti-PAC1R antibody (AMG-301, red line) or human IgG control (black line). E , F Dose-response curves for calcium mobilization ( E ) and cAMP production ( F ) in neuroblastoma cells stimulated with PACAP38. Calcium mobilization was measured using Cal-520 AM, and cAMP production was assessed using the LANCE Ultra cAMP detection kit. For curve fitting, all data were analyzed using nonlinear regression (three-parameter fit) in GraphPad Prism, without applying constraints to the minimum or maximum values. Data represent the mean ± SEM of n = 3 independent experiments

Article Snippet: For CRISPR-Cas9 gene editing, non-targeting control sgRNA and guide RNAs targeting ADCYAP1R1 , GNAS , GNA12 and GNA13 were cloned into the lentiCRISPR-v2 vector (#52961, Addgene) or pSpCas9(BB)−2 A-puro (PX459) V2.0 (#62988, Addgene), gifts from Feng Zhang.

Techniques: Expressing, Comparison, Two Tailed Test, Flow Cytometry, Staining, Control

PACAP38-induced proliferation and migration of SH-SY5Y cells are mediated by PAC1R. A Dose-response curves showing SH-SY5Y cell proliferation in response to PAC1R agonists. Cells were treated for 72 h with increasing concentrations of PACAP38, PACAP27, VIP, or maxadilan, and proliferation was assessed using the CCK-8 assay. B mRNA expression of key G1/S cell cycle regulators ( CDK4 , CDK6 , and CCND1 ) was quantified by RT-qPCR after 24 h of PACAP38 (10 nM) stimulation under complete medium conditions. C Comparison of PACAP38-induced proliferation between control and ADCYAP1R1 knockout SH-SY5Y cells after 72 h of treatment. D EdU incorporation assay showing enhanced DNA synthesis following PACAP38 treatment. Cells were treated for 48 h with vehicle (0.001% TDW, v/v) or PACAP38 (10 nM), and DNA synthesis was assessed using the EdU staining kit. E Western blot analysis of cyclin D1 expression in control and PAC1R-deficient cells treated with or without PACAP38 (10 nM) for 24 h under complete medium conditions. F Transwell migration assay showing SH-SY5Y cell migration toward various concentrations of PACAP38. Cells were seeded in the upper chamber and allowed to migrate for 16 h. G Effect of PAC1R deficiency on PACAP38-induced cell migration. Control and PAC1R-deficient SH-SY5Y cells were treated with or without PACAP38 (10 nM) for 16 h, and migrated cells were quantified. Data represent the mean ± SEM of n = 3 independent experiments. Statistical significance was analyzed using two-way ANOVA followed by Bonferroni’s multiple comparison test (A: compared with VIP response; C: compared with sgControl) and unpaired two-tailed Student’s t -test (B, D-G). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant

Journal: Cell Communication and Signaling : CCS

Article Title: Activation of the pituitary adenylate cyclase-activating polypeptide type I receptor promotes neuroblastoma proliferation and migration through distinct G protein pathways

doi: 10.1186/s12964-026-02660-2

Figure Lengend Snippet: PACAP38-induced proliferation and migration of SH-SY5Y cells are mediated by PAC1R. A Dose-response curves showing SH-SY5Y cell proliferation in response to PAC1R agonists. Cells were treated for 72 h with increasing concentrations of PACAP38, PACAP27, VIP, or maxadilan, and proliferation was assessed using the CCK-8 assay. B mRNA expression of key G1/S cell cycle regulators ( CDK4 , CDK6 , and CCND1 ) was quantified by RT-qPCR after 24 h of PACAP38 (10 nM) stimulation under complete medium conditions. C Comparison of PACAP38-induced proliferation between control and ADCYAP1R1 knockout SH-SY5Y cells after 72 h of treatment. D EdU incorporation assay showing enhanced DNA synthesis following PACAP38 treatment. Cells were treated for 48 h with vehicle (0.001% TDW, v/v) or PACAP38 (10 nM), and DNA synthesis was assessed using the EdU staining kit. E Western blot analysis of cyclin D1 expression in control and PAC1R-deficient cells treated with or without PACAP38 (10 nM) for 24 h under complete medium conditions. F Transwell migration assay showing SH-SY5Y cell migration toward various concentrations of PACAP38. Cells were seeded in the upper chamber and allowed to migrate for 16 h. G Effect of PAC1R deficiency on PACAP38-induced cell migration. Control and PAC1R-deficient SH-SY5Y cells were treated with or without PACAP38 (10 nM) for 16 h, and migrated cells were quantified. Data represent the mean ± SEM of n = 3 independent experiments. Statistical significance was analyzed using two-way ANOVA followed by Bonferroni’s multiple comparison test (A: compared with VIP response; C: compared with sgControl) and unpaired two-tailed Student’s t -test (B, D-G). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant

Article Snippet: For CRISPR-Cas9 gene editing, non-targeting control sgRNA and guide RNAs targeting ADCYAP1R1 , GNAS , GNA12 and GNA13 were cloned into the lentiCRISPR-v2 vector (#52961, Addgene) or pSpCas9(BB)−2 A-puro (PX459) V2.0 (#62988, Addgene), gifts from Feng Zhang.

Techniques: Migration, CCK-8 Assay, Expressing, Quantitative RT-PCR, Comparison, Control, Knock-Out, DNA Synthesis, Staining, Western Blot, Transwell Migration Assay, Two Tailed Test

Pharmacological characterization of PAC1R agonist signaling profiles. A Concentration-response curves for G protein activation by PAC1R agonists in HEK293A cells co-expressing PAC1R, Gα-Rluc8, Gβ, and Gγ-GFP2. Cells were treated with increasing concentrations of PACAP38, PACAP27, VIP, or maxadilan, and activation of GαsS, Gαq, and Gα13 was quantified using the TRUPATH BRET2 assay. B , C Agonist-specific polar area diagrams summarizing the efficacy ( B ) and potency ( C ) of G protein activation by each PAC1R agonist across 14 Gα subtypes. Dose-response curves for individual Gα proteins are provided in Fig. S6, plotted without curve fitting. Efficacy was normalized to the ΔBRET ratio of PACAP38-induced Gα13 activation, which represented the maximal response observed across all conditions. Potency values are expressed as LogEC 50 . E max and LogEC 50 values were derived from independent fits of each experiment. D Activation of Gα13 downstream signaling measured by p115-RhoGEF recruitment to the plasma membrane in HEK293A cells expressing PAC1R, p115-RhoGEF-Rluc8, and rGFP-CAAX after treatment with PAC1R agonists (10 nM). E RhoA activation in response to PAC1R agonists (10 nM), assessed using RhoA BRET2 biosensor in HEK293A cells co-transfected with PAC1R. F Activation of Gα12/13-RhoA-dependent transcription measured using the SRF-RE luciferase reporter assay in HEK293A cells treated with PAC1R agonists (10 nM) for 16 h. Data represent the mean ± SEM of n = 3 independent experiments. Statistical analysis was performed using unpaired two-tailed Student’s t- test. * P < 0.05, ** P < 0.01, *** P < 0.001; ns, not significant

Journal: Cell Communication and Signaling : CCS

Article Title: Activation of the pituitary adenylate cyclase-activating polypeptide type I receptor promotes neuroblastoma proliferation and migration through distinct G protein pathways

doi: 10.1186/s12964-026-02660-2

Figure Lengend Snippet: Pharmacological characterization of PAC1R agonist signaling profiles. A Concentration-response curves for G protein activation by PAC1R agonists in HEK293A cells co-expressing PAC1R, Gα-Rluc8, Gβ, and Gγ-GFP2. Cells were treated with increasing concentrations of PACAP38, PACAP27, VIP, or maxadilan, and activation of GαsS, Gαq, and Gα13 was quantified using the TRUPATH BRET2 assay. B , C Agonist-specific polar area diagrams summarizing the efficacy ( B ) and potency ( C ) of G protein activation by each PAC1R agonist across 14 Gα subtypes. Dose-response curves for individual Gα proteins are provided in Fig. S6, plotted without curve fitting. Efficacy was normalized to the ΔBRET ratio of PACAP38-induced Gα13 activation, which represented the maximal response observed across all conditions. Potency values are expressed as LogEC 50 . E max and LogEC 50 values were derived from independent fits of each experiment. D Activation of Gα13 downstream signaling measured by p115-RhoGEF recruitment to the plasma membrane in HEK293A cells expressing PAC1R, p115-RhoGEF-Rluc8, and rGFP-CAAX after treatment with PAC1R agonists (10 nM). E RhoA activation in response to PAC1R agonists (10 nM), assessed using RhoA BRET2 biosensor in HEK293A cells co-transfected with PAC1R. F Activation of Gα12/13-RhoA-dependent transcription measured using the SRF-RE luciferase reporter assay in HEK293A cells treated with PAC1R agonists (10 nM) for 16 h. Data represent the mean ± SEM of n = 3 independent experiments. Statistical analysis was performed using unpaired two-tailed Student’s t- test. * P < 0.05, ** P < 0.01, *** P < 0.001; ns, not significant

Article Snippet: For CRISPR-Cas9 gene editing, non-targeting control sgRNA and guide RNAs targeting ADCYAP1R1 , GNAS , GNA12 and GNA13 were cloned into the lentiCRISPR-v2 vector (#52961, Addgene) or pSpCas9(BB)−2 A-puro (PX459) V2.0 (#62988, Addgene), gifts from Feng Zhang.

Techniques: Concentration Assay, Activation Assay, Expressing, Derivative Assay, Clinical Proteomics, Membrane, Transfection, Luciferase, Reporter Assay, Two Tailed Test

PAC1R-mediated neuroblastoma migration requires convergent Gαq/11 and Gα12/13 signaling to activate RhoA. A PACAP38-induced cell migration in control and Gαs knockout SH-SY5Y cells. Cells were treated with PACAP38 (10 nM) and allowed to migrate for 16 h. Migration was assessed using a transwell migration assay. B Effect of Gαq/11 inhibitor on PACAP38-induced cell migration in control and Gα12,13-deficient SH-SY5Y cells. Cells were pretreated with vehicle (0.001% DMSO, v/v) or Gαq/11 inhibitor YM-254,890 (100 nM, 30 min), followed by treatment with PACAP38 (10 nM). Migration was assessed after 16 h using a transwell migration assay. C Validation of Gα12 and Gα13 knockout in SH-SY5Y cells. Cells were transduced with lentiviruses encoding sgControl or sgRNAs targeting GNA12 and GNA13 (sg GNA12 and sgGNA13 ). Gα12 and Gα13 protein levels were assessed by western blotting following puromycin and G418 selection. D Role of PAC1R in PACAP38-induced RhoA activation. Control and PAC1R-deficient SH-SY5Y cells were transduced with adenoviruses encoding RhoA-BRET2 biosensor and stimulated with PACAP38 (10 nM) to assess RhoA activation. E Effects of RhoA and ROCK inhibitors on PACAP38-induced SH-SY5Y cell migration. Cells were pretreated with vehicle (0.001% DMSO, v/v), rhosin (50 µM), Y-27,632 (10 µM), or fasudil (10 µM) for 30 min, followed by treatment with PACAP38 (10 nM). Migration was assessed after 16 h using a transwell migration assay. Data represent the mean ± SEM of n = 3 independent experiments. Statistical significance was assessed using unpaired two-tailed Student’s t -test. ** P < 0.01, *** P < 0.001; ns, not significant

Journal: Cell Communication and Signaling : CCS

Article Title: Activation of the pituitary adenylate cyclase-activating polypeptide type I receptor promotes neuroblastoma proliferation and migration through distinct G protein pathways

doi: 10.1186/s12964-026-02660-2

Figure Lengend Snippet: PAC1R-mediated neuroblastoma migration requires convergent Gαq/11 and Gα12/13 signaling to activate RhoA. A PACAP38-induced cell migration in control and Gαs knockout SH-SY5Y cells. Cells were treated with PACAP38 (10 nM) and allowed to migrate for 16 h. Migration was assessed using a transwell migration assay. B Effect of Gαq/11 inhibitor on PACAP38-induced cell migration in control and Gα12,13-deficient SH-SY5Y cells. Cells were pretreated with vehicle (0.001% DMSO, v/v) or Gαq/11 inhibitor YM-254,890 (100 nM, 30 min), followed by treatment with PACAP38 (10 nM). Migration was assessed after 16 h using a transwell migration assay. C Validation of Gα12 and Gα13 knockout in SH-SY5Y cells. Cells were transduced with lentiviruses encoding sgControl or sgRNAs targeting GNA12 and GNA13 (sg GNA12 and sgGNA13 ). Gα12 and Gα13 protein levels were assessed by western blotting following puromycin and G418 selection. D Role of PAC1R in PACAP38-induced RhoA activation. Control and PAC1R-deficient SH-SY5Y cells were transduced with adenoviruses encoding RhoA-BRET2 biosensor and stimulated with PACAP38 (10 nM) to assess RhoA activation. E Effects of RhoA and ROCK inhibitors on PACAP38-induced SH-SY5Y cell migration. Cells were pretreated with vehicle (0.001% DMSO, v/v), rhosin (50 µM), Y-27,632 (10 µM), or fasudil (10 µM) for 30 min, followed by treatment with PACAP38 (10 nM). Migration was assessed after 16 h using a transwell migration assay. Data represent the mean ± SEM of n = 3 independent experiments. Statistical significance was assessed using unpaired two-tailed Student’s t -test. ** P < 0.01, *** P < 0.001; ns, not significant

Article Snippet: For CRISPR-Cas9 gene editing, non-targeting control sgRNA and guide RNAs targeting ADCYAP1R1 , GNAS , GNA12 and GNA13 were cloned into the lentiCRISPR-v2 vector (#52961, Addgene) or pSpCas9(BB)−2 A-puro (PX459) V2.0 (#62988, Addgene), gifts from Feng Zhang.

Techniques: Migration, Control, Knock-Out, Transwell Migration Assay, Biomarker Discovery, Transduction, Western Blot, Selection, Activation Assay, Two Tailed Test

PACAP38-induced proliferation and migration of neuroblastoma cells are fully inhibited by AMG-301. A Effects of PAC1R inhibitors on PACAP38-induced cell proliferation. SH-SY5Y cells were pretreated for 1 h with human IgG control or increasing concentrations of PAC1R inhibitors (AMG-301, M65, or PACAP-6–38), followed by vehicle (0.001% TDW, v/v) of treatment with PACAP38 (5 nM) for 72 h. Proliferation was assessed using the CCK-8 assay. Proliferation was assessed using the CCK-8 assay. B Effects of PAC1R inhibitors on PACAP38-induced migration. SH-SY5Y cells were pretreated with vehicle (0.001% TDW, v/v) or PAC1R inhibitors (100 nM) for 1 h, and cell migration toward PACAP38 (5 nM) was assessed using the transwell migration assay. C Effects of PAC1R inhibitors on PACAP38-induced RhoA activation. SH-SY5Y cells transduced with adenoviruses encoding RhoA-BRET2 biosensor were pretreated with PAC1R inhibitors (100 nM, 1 h), and then stimulated with PACAP38 (5 nM). RhoA activation was measured using BRET2. D Effects of PAC1R inhibitors on PACAP38-induced calcium mobilization. Cells were pretreated with PAC1R inhibitors (100 nM) for 1 h, followed by stimulation with PACAP38 (5 nM). Calcium responses were measured using Cal-520 AM. Data represent the mean ± SEM of n = 3 independent experiments. Statistical significance was determined using unpaired two-tailed Student’s t- test. * P < 0.05, ** P < 0.01; ns, not significant

Journal: Cell Communication and Signaling : CCS

Article Title: Activation of the pituitary adenylate cyclase-activating polypeptide type I receptor promotes neuroblastoma proliferation and migration through distinct G protein pathways

doi: 10.1186/s12964-026-02660-2

Figure Lengend Snippet: PACAP38-induced proliferation and migration of neuroblastoma cells are fully inhibited by AMG-301. A Effects of PAC1R inhibitors on PACAP38-induced cell proliferation. SH-SY5Y cells were pretreated for 1 h with human IgG control or increasing concentrations of PAC1R inhibitors (AMG-301, M65, or PACAP-6–38), followed by vehicle (0.001% TDW, v/v) of treatment with PACAP38 (5 nM) for 72 h. Proliferation was assessed using the CCK-8 assay. Proliferation was assessed using the CCK-8 assay. B Effects of PAC1R inhibitors on PACAP38-induced migration. SH-SY5Y cells were pretreated with vehicle (0.001% TDW, v/v) or PAC1R inhibitors (100 nM) for 1 h, and cell migration toward PACAP38 (5 nM) was assessed using the transwell migration assay. C Effects of PAC1R inhibitors on PACAP38-induced RhoA activation. SH-SY5Y cells transduced with adenoviruses encoding RhoA-BRET2 biosensor were pretreated with PAC1R inhibitors (100 nM, 1 h), and then stimulated with PACAP38 (5 nM). RhoA activation was measured using BRET2. D Effects of PAC1R inhibitors on PACAP38-induced calcium mobilization. Cells were pretreated with PAC1R inhibitors (100 nM) for 1 h, followed by stimulation with PACAP38 (5 nM). Calcium responses were measured using Cal-520 AM. Data represent the mean ± SEM of n = 3 independent experiments. Statistical significance was determined using unpaired two-tailed Student’s t- test. * P < 0.05, ** P < 0.01; ns, not significant

Article Snippet: For CRISPR-Cas9 gene editing, non-targeting control sgRNA and guide RNAs targeting ADCYAP1R1 , GNAS , GNA12 and GNA13 were cloned into the lentiCRISPR-v2 vector (#52961, Addgene) or pSpCas9(BB)−2 A-puro (PX459) V2.0 (#62988, Addgene), gifts from Feng Zhang.

Techniques: Migration, Control, CCK-8 Assay, Transwell Migration Assay, Activation Assay, Transduction, Two Tailed Test

Schematic diagram of PAC1R-mediated signaling pathways regulating neuroblastoma cell proliferation and migration. Upon binding of PACAP38, PAC1R activates multiple G protein pathways, including Gαs, Gα12/13, and Gαq/11. Activation of Gαs promotes cell proliferation via the cAMP/EPAC pathway, which stimulates ERK and AKT signaling independently of PKA. Concurrently, activation of Gαq/11 and Gα12/13 drives cell migration through the RhoGEF/RhoA/ROCK signaling axis. The PAC1R-selective antibody AMG-301 effectively blocks PACAP38-induced G protein activation, as well as downstream proliferative and migratory responses in neuroblastoma cells. The figure was created using BioRender.com

Journal: Cell Communication and Signaling : CCS

Article Title: Activation of the pituitary adenylate cyclase-activating polypeptide type I receptor promotes neuroblastoma proliferation and migration through distinct G protein pathways

doi: 10.1186/s12964-026-02660-2

Figure Lengend Snippet: Schematic diagram of PAC1R-mediated signaling pathways regulating neuroblastoma cell proliferation and migration. Upon binding of PACAP38, PAC1R activates multiple G protein pathways, including Gαs, Gα12/13, and Gαq/11. Activation of Gαs promotes cell proliferation via the cAMP/EPAC pathway, which stimulates ERK and AKT signaling independently of PKA. Concurrently, activation of Gαq/11 and Gα12/13 drives cell migration through the RhoGEF/RhoA/ROCK signaling axis. The PAC1R-selective antibody AMG-301 effectively blocks PACAP38-induced G protein activation, as well as downstream proliferative and migratory responses in neuroblastoma cells. The figure was created using BioRender.com

Article Snippet: For CRISPR-Cas9 gene editing, non-targeting control sgRNA and guide RNAs targeting ADCYAP1R1 , GNAS , GNA12 and GNA13 were cloned into the lentiCRISPR-v2 vector (#52961, Addgene) or pSpCas9(BB)−2 A-puro (PX459) V2.0 (#62988, Addgene), gifts from Feng Zhang.

Techniques: Protein-Protein interactions, Migration, Binding Assay, Activation Assay